rs556059 chr8:102980362 A>G
- Sequence
gtgagagcatctaatgtaccactg[A/G]tggctgagagcatgcatttaagac
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | 0.27 | 0.71 | 1.54 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, asthma, mitral annular calcium, resistance to kuru in aged women despite likely exposure