rs55650318 chr16:86394003 G>C
- Sequence
cattatcaccatcattatcaccat[G/C]atgaccatcatcatcatcaccatc
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) HepG2 (hepatoblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | -0.01 | 0.87 | 1.72 | |||
| HepG2 (hepatoblastoma) | -0.21 | 1.02 | 2.00 |
Items per page:
1 – 2 of 2