rs55717710 chr2:26012689 C>T
- Sequence
ctgtgtcactgagctatggcaccc[C/T]gatgagtcatgctttcccacacag
- ASB in cell types
- A549 (lung carcinoma) HCT-116 (colon carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| A549 (lung carcinoma) | 0.26 | 0.57 | 1.40 | |||
| HCT-116 (colon carcinoma) | 0.03 | 1.03 | 1.31 |
Items per page:
1 – 2 of 2