rs55731255 chr20:44885402 A>G
- Sequence
aatccccatccagaccacactcct[A/G]gtcctccttattcccacacagccc
- ASB in cell types
- HEK293 (embryonic kidney) GM12878 (female B-cells) HEK293T (embryonic kidney)
- ASB for transcription factors
- FOXK2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| FOXK2_HUMAN | 1.61 | -1.91 | 1.50 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Cells_EBV-transformed_lymphocytes, Esophagus_Gastroesophageal_Junction, Lung, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Stomach, Thyroid