rs55738054 chr7:44921738 G>A
- Sequence
ggtgttcttacctactgaatgggc[G/A]ggctagatcaagaggtgacaacct
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma)
- ASB for transcription factors
- GATA3_HUMAN PKNX1_HUMAN RFX1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GATA3_HUMAN | 2.00 | n/a | 2.50 | n/a | No Hit | |||
| PKNX1_HUMAN | 2.40 | n/a | 2.50 | n/a | No Hit | |||
| RFX1_HUMAN | 2.56 | n/a | 3.00 | n/a | No Hit |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Stomach, Thyroid, Whole_Blood