rs55793272 chr4:38856861 G>A
- Sequence
aagttcttaaagttgagtaaagcg[G/A]taccttagaaacagattggtgcca
- ASB in cell types
- GM12878 (female B-cells) gastroesophageal sphincter neutrophils
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells) | 0.73 | 0.31 | 1.34 | |||
| gastroesophageal sphincter | -0.74 | 0.76 | 1.22 | |||
| neutrophils | 2.00 | 0.41 | 1.67 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adrenal_Gland, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Putamen_basal_ganglia, Esophagus_Mucosa, Muscle_Skeletal, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid