rs55833887 chr4:83536848 A>G
- Sequence
cagttctcaaggtcagtggtcgcg[A/G]gtcaggggtgtgtgtgcgcgcgtg
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- NRF1_HUMAN KDM1A_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| NRF1_HUMAN | 2.03 | -1.35 | 2.00 | n/a | No Hit | |||
| KDM1A_HUMAN | 1.62 | -0.51 | 1.67 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Frontal_Cortex_BA9, Muscle_Skeletal, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis