rs55849896 chr14:105093152 G>C
- Sequence
gcaagagtggattcctgagcaaaa[G/C]ctccgcgggtggagaaagagagta
- ASB in cell types
- HEK293 (embryonic kidney) HEK293T (embryonic kidney) GM12878 (female B-cells)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.76 | -0.02 | 1.91 | |||
| HEK293T (embryonic kidney) | 1.13 | -0.27 | 2.00 | |||
| GM12878 (female B-cells) | 0.62 | 0.40 | 1.30 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Tibial, Cells_Cultured_fibroblasts, Colon_Sigmoid, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Lung, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Small_Intestine_Terminal_Ileum, Testis