rs558765 chr1:212470150 A>G
- Sequence
gctgcccttgccctgcgagcatgt[A/G]cactcgccaggcagtcccggatga
- ASB in cell types
- K562 (myelogenous leukemia) HCT-116 (colon carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -0.95 | 1.48 | 2.62 | |||
| HCT-116 (colon carcinoma) | -0.65 | 1.32 | 1.25 |
Items per page:
1 – 2 of 2