rs559148826 chr7:149125749 C>A
- Sequence
gcagtggctattcacaggcgcgat[C/A]ccactaacgatcagcactggggtt
- ASB in cell types
- HEK293 (embryonic kidney) HEK293T (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.88 | -0.20 | 1.95 | |||
| HEK293T (embryonic kidney) | 0.78 | -0.18 | 1.79 |
Items per page:
1 – 2 of 2