rs559188 chr18:35149941 C>T
- Sequence
tcccttaaatgcccttctttgtct[C/T]ttttgatctctgtttgtttaaagt
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -0.58 | 1.19 | 2.25 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Heart_Atrial_Appendage, Muscle_Skeletal, Nerve_Tibial, Whole_Blood