rs55938549 chr19:39124347 T>A
- Sequence
ccaacagtgctggggcactgggaa[T/A]gcagcagtgaacaaagacagaaat
- ASB in cell types
- HEK293 (embryonic kidney) K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | -0.64 | 1.02 | 4.59 | |||
| K562 (myelogenous leukemia) | -0.29 | 0.70 | 2.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Hippocampus, Cells_Cultured_fibroblasts, Pancreas, Spleen, Testis, Thyroid, Whole_Blood