rs560354 chr11:126193297 C>T
- Sequence
tggctccttgaagctgctgatgga[C/T]agatggtaatcgctcccagcctgc
- ASB in cell types
- HepG2 (hepatoblastoma) cranial neural crest cells
- ASB for transcription factors
- SMAD4_HUMAN RARA_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SMAD4_HUMAN | 1.95 | n/a | 1.50 | n/a | No Hit | |||
| RARA_HUMAN | 1.64 | n/a | 1.33 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP fasting insulin, homa-ir, ldl cholesterol, total cholesterol, triglycerides, triglycerides change with statins
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Mucosa, Esophagus_Muscularis, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid, Whole_Blood