rs561159 chr1:234314248 G>A
- Sequence
agaccaaaaggtcaatgtccaacc[G/A]tgctctcatttcctacccccttgt
- ASB in cell types
- liver
- ASB for transcription factors
- HNF4A_HUMAN SP1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| HNF4A_HUMAN | 2.91 | 1.44 | 1.33 | n/a | No Hit | |||
| SP1_HUMAN | 2.30 | -2.57 | 1.33 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP amyotrophic lateral sclerosis (als), college completion, comorbid depressive syndrome and alcohol dependence, hdl cholesterol change with statins, years of education