rs561233 chr1:179937765 G>A
- Sequence
ttttgtgggctttctgttaatgca[G/A]taggatttgtaaccaaatgctcac
- ASB in cell types
- HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.62 | -0.14 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP aortic valve calcium, atopy, college completion, hypertension (early onset hypertension), ldl cholesterol, sporadic creutzfeldt-jakob disease, total cholesterol
GTEx eQTL Adrenal_Gland, Artery_Tibial, Brain_Anterior_cingulate_cortex_BA24, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Nerve_Tibial, Testis, Thyroid, Whole_Blood