rs561289 chr1:78145185 T>A
- Sequence
caacaccaaatggcctagtatggc[T/A]gaagttaattcactaggctatttc
- ASB in cell types
- B-cells
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| B-cells | 1.84 | -1.55 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP bipolar disorder, body mass index (bmi), diastolic blood pressure (dbp), height, ldl cholesterol, systolic blood pressure (sbp), urinary albumin-to-creatinine ratio, waist hip ratio
GTEx eQTL Adrenal_Gland, Cells_Cultured_fibroblasts, Colon_Transverse, Liver, Lung, Nerve_Tibial, Pancreas, Skin_Sun_Exposed_Lower_leg, Spleen, Testis