rs56131459 chr14:20613327 C>T
- Sequence
taatagctgcaatttttcaaagaa[C/T]ggtatacagggacagcaaagtgca
- ASB in cell types
- GM12878 (female B-cells) A549 (lung carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells) | 0.87 | 0.28 | 1.26 | |||
| A549 (lung carcinoma) | -0.32 | 0.99 | 2.07 |
Items per page:
1 – 2 of 2