rs561460 chr11:124071724 T>C
- Sequence
gctatagtctttctagagagccag[T/C]taaataaccagtcaattgctacca
- ASB in cell types
- K562 (myelogenous leukemia) foreskin keratinocyte PC9 (lung adenocarcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.79 | -0.24 | 2.00 | |||
| foreskin keratinocyte | 1.95 | n/a | 2.83 | |||
| PC9 (lung adenocarcinoma) | -0.32 | 0.96 | 1.33 |
Items per page:
1 – 3 of 3