rs561931 chr1:119711883 A>G
- Sequence
ccgtccaatcaaaaggagactgta[A/G]gaggaggaggaggaggagatgact
- ASB in cell types
- K562 (myelogenous leukemia) HeLa S3 (cervical adenocarcinoma)
- ASB for transcription factors
- TAF7_HUMAN NFIC_HUMAN KAISO_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TAF7_HUMAN | -2.15 | 2.20 | 1.33 | n/a | n/a | |||
| NFIC_HUMAN | -1.81 | 1.98 | 1.33 | n/a | No Hit | |||
| KAISO_HUMAN | 1.78 | -1.68 | 1.33 | n/a | No Hit |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, diastolic blood pressure (dbp), ldl cholesterol, systolic blood pressure (sbp), total cholesterol, urinary albumin-to-creatinine ratio
GTEx eQTL Artery_Tibial, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis