rs56217714 chr2:38600823 C>G
- Sequence
agccctactcagtgccatttccac[C/G]gctccacacatttcgctttggata
- ASB in cell types
- K562 (myelogenous leukemia) HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -0.22 | 0.78 | 1.99 | |||
| HEK293 (embryonic kidney) | 0.46 | 0.42 | 1.30 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Colon_Sigmoid, Colon_Transverse, Esophagus_Muscularis, Skin_Sun_Exposed_Lower_leg