rs56224295 chr11:118291176 G>A
- Sequence
tactaggttctgcaaaccgaggtc[G/A]gaggaaggctctaaacagtgattc
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) T47D (invasive ductal carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | 0.97 | 0.05 | 1.76 | |||
| T47D (invasive ductal carcinoma) | 0.97 | -0.28 | 1.87 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Esophagus_Mucosa, Muscle_Skeletal, Pancreas, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Stomach, Thyroid, Whole_Blood