rs56247470 chr2:31475825 G>T
- Sequence
agaataagtctgtagtgtagaaca[G/T]tgacacatagttcctatcaaaact
- ASB in cell types
- coronary artery smooth muscle
- ASB for transcription factors
- JUND_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| JUND_HUMAN | 2.79 | -3.09 | 1.33 | -2.14 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Brain_Cerebellum, Cells_Cultured_fibroblasts, Lung, Muscle_Skeletal, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid