rs56259592 chr17:57086024 C>G
- Sequence
gccgggacatcggccggttgtgat[C/G]caaccgtgtttcgggctgagggac
- ASB in cell types
- K562 (myelogenous leukemia) GM12878 (female B-cells)
- ASB for transcription factors
- KDM1A_HUMAN FOXK2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| KDM1A_HUMAN | 1.69 | -0.90 | 2.00 | n/a | n/a | |||
| FOXK2_HUMAN | 1.21 | -1.27 | 1.78 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Cells_Cultured_fibroblasts, Muscle_Skeletal, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg