rs56324004 chr4:114071209 A>T
- Sequence
tactcctaaatgccatctactgga[A/T]gaaccctgaattacatcaccatac
- ASB in cell types
- foreskin keratinocyte upper lobe of left lung esophagus squamous epithelium LNCaP (prostate carcinoma)
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.80 | -0.47 | 1.48 | -0.04 | Weak Concordant |
Items per page:
1 – 1 of 1
Motif analysis
