rs563256 chr1:110108156 G>A
- Sequence
ccacgcccatccatcttccctgcc[G/A]gacattgtgcttgtttcccagtga
- ASB in cell types
- CLB-Ga (neuroblastoma)
- ASB for transcription factors
- HAND2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| HAND2_HUMAN | -2.14 | 1.95 | 1.33 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP age at death with kuru exposure, autism, bipolar disorder, infant head circumference, microalbuminuria, urinary albumin-to-creatinine ratio