rs563995 chr19:43774629 G>A
- Sequence
gtcggtcatgaacagctgccggta[G/A]ggggccaagaagggaggggtcagg
- ASB in cell types
- HepG2 (hepatoblastoma) adrenal gland neural cell upper lobe of left lung
- ASB for transcription factors
- CTCF_HUMAN GATA1_HUMAN EP300_HUMAN NR2F6_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.78 | -0.58 | 1.33 | -4.64 | Concordant | |||
| GATA1_HUMAN | -0.25 | 1.47 | 1.58 | n/a | No Hit | |||
| EP300_HUMAN | n/a | 2.60 | 2.00 | n/a | n/a | |||
| NR2F6_HUMAN | 1.85 | -2.22 | 1.33 | n/a | n/a | |||
| RAD21_HUMAN | 1.43 | -1.18 | 1.25 | n/a | n/a |
Items per page:
1 – 5 of 6
Motif analysis
Genetic associations
EMBL-EBI hemoglobin concentration, mean corpuscular hemoglobin concentration, mean corpuscular volume
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Tibial, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Esophagus_Muscularis, Lung, Muscle_Skeletal, Spleen, Testis, Thyroid