rs56400542 chr16:11641443 G>A
- Sequence
agcacgatcagcaggagaaagcag[G/A]ccatgcgcaggtgatgtgggtgcc
- ASB in cell types
- HEK293 (embryonic kidney) K562 (myelogenous leukemia) upper lobe of left lung MCF7 (Invasive ductal breast carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | -0.27 | 0.77 | 1.96 | |||
| K562 (myelogenous leukemia) | 0.64 | -0.15 | 2.00 | |||
| upper lobe of left lung | 1.56 | -0.71 | 1.17 | |||
| MCF7 (Invasive ductal breast carcinoma) | 0.53 | -0.03 | 1.78 |
Items per page:
1 – 4 of 4