rs564891557 chr15:90954575 C>T
- Sequence
gagcgcagcctcccaaagtgtcgc[C/T]tgggcgacacagcgagaccctatc
- ASB in cell types
- K562 (myelogenous leukemia) GM12878 (female B-cells)
- ASB for transcription factors
- RFX1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RFX1_HUMAN | 2.42 | n/a | 1.75 | -3.69 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
