rs565269851 chr2:181683658 C>G
- Sequence
caatgccccaaatctgccgcctcc[C/G]gggtccccgctctgagcgcgcggc
- ASB in cell types
- cranial neural crest cells
- ASB for transcription factors
- AP2A_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| AP2A_HUMAN | 1.92 | -2.62 | 2.00 | n/a | No Hit |
Items per page:
1 – 1 of 1