rs565429 chr7:81167995 C>A
- Sequence
gggtggaaacttgggagattgggg[C/A]tgtaagacctgcaagtgaagttgt
- ASB in cell types
- ZR-75-1 (invasive ductal carcinoma) MCF7 (Invasive ductal breast carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| ZR-75-1 (invasive ductal carcinoma) | 2.04 | -1.43 | 2.00 | |||
| MCF7 (Invasive ductal breast carcinoma) | 0.58 | 0.71 | 1.52 |
Items per page:
1 – 2 of 2