rs566237 chr6:11543109 A>G
- Sequence
tcttgctacttctgctctttgtac[A/G]tatttttattatgtttttcaatta
- ASB in cell types
- periferal blood macrophages monocyte-derived macrophages
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| periferal blood macrophages | 2.43 | n/a | 2.50 | |||
| monocyte-derived macrophages | -3.02 | 2.14 | 2.50 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Transverse, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Testis, Whole_Blood