rs566408 chr18:35085797 C>G
- Sequence
tcagtccaacactgacgttttgca[C/G]ataagaatactgttggcttagcag
- ASB in cell types
- SK-N-SH (neuroblastoma) HepG2 (hepatoblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| SK-N-SH (neuroblastoma) | -1.84 | 1.85 | 1.50 | |||
| HepG2 (hepatoblastoma) | 0.29 | 0.71 | 1.34 |
Items per page:
1 – 2 of 2