rs566742 chr6:36427891 G>A
- Sequence
tgtcaaatagaattgtgactcatc[G/A]tttttcaaatgtaccatattttcc
- ASB in cell types
- A549 (lung carcinoma)
- ASB for transcription factors
- MAFK_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| MAFK_HUMAN | -2.51 | 2.74 | 1.00 | 3.29 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP late onset alzheimers disease, obesity with early age of onset (age >2), salmonella-induced pyroptosis, transmission distortion
GTEx eQTL Adipose_Subcutaneous, Adrenal_Gland, Brain_Cerebellum, Cells_Cultured_fibroblasts, Colon_Transverse, Esophagus_Mucosa, Liver, Lung, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Stomach, Testis, Whole_Blood