rs56679579 chr10:103482082 G>C
- Sequence
tattgagagggctgtttaggacta[G/C]atgccccctactggagaaactcgt
- ASB in cell types
- foreskin keratinocyte HeLa S3 (cervical adenocarcinoma)
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.42 | 1.21 | 1.86 | -1.39 | Weak Discordant |
Items per page:
1 – 1 of 1
Motif analysis
