rs568557 chr9:113602846 G>T
- Sequence
ggtttttcacaagctcctgccctt[G/T]aggcaaagtccatccccacttttt
- ASB in cell types
- HepG2 (hepatoblastoma)
- ASB for transcription factors
- RXRB_HUMAN RARA_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RXRB_HUMAN | 1.83 | -1.52 | 1.33 | n/a | No Hit | |||
| RARA_HUMAN | 1.67 | -1.30 | 1.33 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP hdl cholesterol, height, microalbuminuria, systolic blood pressure (sbp), total cholesterol, variant creutzfeldt-jakob disease
GTEx eQTL Artery_Aorta, Artery_Tibial, Cells_Cultured_fibroblasts, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Lung, Muscle_Skeletal, Skin_Sun_Exposed_Lower_leg, Stomach, Testis, Whole_Blood