rs568610148 chr17:77140606 T>C
- Sequence
tcccgctcagccgaacccctcccc[T/C]gcacgccggcagccccttggggct
- ASB in cell types
- cranial neural crest cells
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| cranial neural crest cells | 1.89 | -2.59 | 2.00 |
Items per page:
1 – 1 of 1