rs56943284 chr4:85084630 G>A
- Sequence
agttgaaaggcagtggtgttacca[G/A]acatgaagtatactggctgatgcg
- ASB in cell types
- foreskin keratinocyte A549 (lung carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 0.74 | n/a | 2.33 | |||
| A549 (lung carcinoma) | 0.43 | 0.66 | 1.15 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Tibial, Brain_Cerebellar_Hemisphere, Esophagus_Muscularis, Heart_Left_Ventricle, Thyroid