rs570613 chr10:8064539 C>T
- Sequence
agatagagacatttagtatgagga[C/T]ggaatgttccagaaaccatccaga
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | 0.06 | 0.73 | 1.66 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, adult asthma, asthma, irritible bowel syndrome, rheumatoid arthritis, suicide attempts in bipolar disorder (females), tetrology of fallot, triglycerides