rs570975 chr18:45850174 G>A
- Sequence
tggtgaagtctggagcctgcagcc[G/A]ttcgccctccacgctgctcagtcc
- ASB in cell types
- lymphoblastoid cells GM19238 (female B-cells)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| lymphoblastoid cells | 1.49 | n/a | 1.33 | |||
| GM19238 (female B-cells) | 1.49 | n/a | 1.33 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Brain_Frontal_Cortex_BA9, Cells_Cultured_fibroblasts, Colon_Sigmoid, Esophagus_Gastroesophageal_Junction, Heart_Atrial_Appendage, Heart_Left_Ventricle, Nerve_Tibial, Ovary, Pituitary, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid