rs571468 chr2:21071042 A>C
- Sequence
gggacagaagagaaggctggcgcc[A/C]ctcgtatgccctggagaaacagtg
- ASB in cell types
- HepG2 (hepatoblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HepG2 (hepatoblastoma) | -0.28 | 0.56 | 1.97 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP comorbid depressive syndrome and alcohol dependence, fasting blood glucose, hypertension (early onset hypertension), infant head circumference, parkinsons disease, prop taste detection threshold, triglycerides
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Tibial, Breast_Mammary_Tissue, Heart_Atrial_Appendage, Heart_Left_Ventricle, Liver, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Thyroid