rs571665 chr6:125153645 T>G
- Sequence
aacctaacctgcaatatctctgcg[T/G]tatgcccttatagcgccgggagtg
- ASB in cell types
- K562 (myelogenous leukemia) foreskin keratinocyte A549 (lung carcinoma) 786-O (renal carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 1.08 | -0.15 | 1.99 | |||
| foreskin keratinocyte | 0.58 | n/a | 2.67 | |||
| A549 (lung carcinoma) | 0.37 | 0.74 | 1.15 | |||
| 786-O (renal carcinoma) | 2.59 | n/a | 2.00 | |||
| GM12878 (female B-cells) | 0.03 | 0.76 | 1.32 |
Items per page:
1 – 5 of 6
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cortex, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Pancreas, Pituitary, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Small_Intestine_Terminal_Ileum, Spleen, Stomach, Testis, Thyroid, Whole_Blood