rs572415 chr17:74931768 C>A
- Sequence
ggagttcgagaccagcctggccaa[C/A]agggtgaaaccctgtctccactaa
- ASB in cell types
- HCT-116 (colon carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HCT-116 (colon carcinoma) | 1.44 | n/a | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Cells_Cultured_fibroblasts, Colon_Sigmoid, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Heart_Atrial_Appendage, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg