rs57265446 chr20:24992833 A>G
- Sequence
gttctccccgccccttccggcctc[A/G]tgggcgggaggtccccggcgcgtc
- ASB in cell types
- HEK293 (embryonic kidney) MCF7 (Invasive ductal breast carcinoma) A549 (lung carcinoma) HEK293T (embryonic kidney)
- ASB for transcription factors
- ZBT17_HUMAN JUN_HUMAN ZXDB_HUMAN TYY1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ZBT17_HUMAN | 2.61 | n/a | 2.00 | n/a | No Hit | |||
| JUN_HUMAN | 1.76 | 0.68 | 2.70 | n/a | No Hit | |||
| ZXDB_HUMAN | 2.06 | -2.35 | 1.50 | n/a | n/a | |||
| TYY1_HUMAN | 1.73 | -1.31 | 2.00 | n/a | No Hit | |||
| ESR1_HUMAN | 2.10 | n/a | 3.00 | n/a | No Hit |
Items per page:
1 – 5 of 5
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Tibial, Cells_Cultured_fibroblasts, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Liver, Lung, Nerve_Tibial, Pancreas, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Stomach, Testis, Thyroid, Whole_Blood