rs574635 chr1:206891046 A>G
- Sequence
agcgcatccgactgtcacaataca[A/G]cagtgctcatgttcaagtcaccct
- ASB in cell types
- upper lobe of left lung HeLa S3 (cervical adenocarcinoma)
- ASB for transcription factors
- EP300_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| EP300_HUMAN | 2.31 | -0.55 | 1.75 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Cells_EBV-transformed_lymphocytes, Lung, Small_Intestine_Terminal_Ileum, Spleen, Thyroid, Whole_Blood