rs574736 chr1:43640595 C>T
- Sequence
caggctcccaaagtgctgggatta[C/T]aggtgtgacccgccacgcccagcc
- ASB in cell types
- foreskin keratinocyte
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | -2.33 | 1.39 | 2.50 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Cells_Cultured_fibroblasts, Colon_Sigmoid, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Muscle_Skeletal, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg, Thyroid, Whole_Blood