rs5748410 chr22:19730621 G>A
- Sequence
caagatggtcatctgtcttgtccc[G/A]caaaggccaagacaaacgccgtgt
- ASB in cell types
- HEK293 (embryonic kidney) foreskin keratinocyte sigmoid colon
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.80 | -0.17 | 1.96 | |||
| foreskin keratinocyte | 0.72 | n/a | 2.50 | |||
| sigmoid colon | 1.65 | -0.14 | 1.17 |
Items per page:
1 – 3 of 3