rs5759313 chr22:43388375 T>C
- Sequence
ctgaaacagctgttgggagaaact[T/C]gtggggaggaggatgtcgcgcccc
- ASB in cell types
- HEK293 (embryonic kidney) PC9 (lung adenocarcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.57 | -0.08 | 2.07 | |||
| PC9 (lung adenocarcinoma) | 1.98 | -1.09 | 3.33 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP cystatin c in serum, height, hip bone mineral density (bmd), prop taste detection threshold, spine bone mineral density (bmd), triglycerides