rs57617983 chr17:76279678 G>A
- Sequence
tctcgggcgccccctggcggccac[G/A]aatgggaatcctggaattcaagcc
- ASB in cell types
- HepG2 (hepatoblastoma) kidney erythroid progenitors epidermal keratinocytes
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HepG2 (hepatoblastoma) | -0.18 | 0.98 | 1.99 | |||
| kidney | 2.31 | -3.35 | 2.00 | |||
| erythroid progenitors | 1.29 | n/a | 2.50 | |||
| epidermal keratinocytes | 1.02 | 2.12 | 2.00 |
Items per page:
1 – 4 of 4
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Cells_Cultured_fibroblasts, Colon_Sigmoid, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Lung, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Testis, Thyroid