rs576808 chr21:41956344 G>A
- Sequence
gaatccgagggcccagtgttcccc[G/A]tgccatgtgtgcacacaggccgcc
- ASB in cell types
- T47D (invasive ductal carcinoma) K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| T47D (invasive ductal carcinoma) | 1.02 | -0.12 | 1.94 | |||
| K562 (myelogenous leukemia) | 0.22 | 0.45 | 1.34 |
Items per page:
1 – 2 of 2