rs5768788 chr22:46462790 G>A
- Sequence
gcagagaatgtgtgtttctgtacc[G/A]ctctcggggtggctctttattttt
- ASB in cell types
- coronary artery smooth muscle
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| coronary artery smooth muscle | -1.80 | 0.65 | 1.50 |
Items per page:
1 – 1 of 1